Human Variation & Race

1. Heat is an environmental stress that disturbs homeostasis and can negatively impact a humans survival. Humans have a core body temperature of 98.6°F which helps maintain homeostasis. When our bodies reach higher temperatures such as 105°F-107°F we can develop hyperthermia which results from failed thermoregulation, or  the ability an organism has to keep its temperature within certain boundaries. Other negative impacts from heat include, heat exhaustion, heat stroke, skin cancers from exposure to high UV rays, and even death.

2. Humans have adapted to heat in several ways through four adaptations: short term, faculative, developmental, and cultural.

Short term: An example of a short term solution to heat is enjoying a swimming pool on a summer day. This is only a temporary response however, because the water can only cool the body so much, especially if you return to strong sun exposure right after. Water as a whole can be considered a short term solution that can be applied throughout the day for more long term cooling effects. For example, drinking plenty of water can help you stay cool for short periods throughout your day.




Faculative: When the temperature is too high sweat glands respond by secreting sweat onto the surface of the skin where it later evaporates. Since water has a high latent of heat evaporation this releases heat from the body. This is a genetic trait therefore it is a faculative adaption.
 


Developmental: 1877 American biologist Joel Allen noted that the length of arms and legs as well as other appendages all have an effect on the amount of heat lost to the surrounding environment. Members of the Masai tribe of East Africa are an example of this because they have tall slender bodies that help aid to the loss of body heat. This is also an example of a developmental trait because members of the Masai tribe inherited these traits.



Cultural: An example of a cultural adaptation to heat is the clothing we wear to keep us cool . Popular trends among U.S. girls these days are skimpy bikinis, small shorts, cropped tops, tank tops, and sandals. While keeping the skin exposed can be harmful over long periods of time, keeping the skin in tight more man- made fiber clothing reduces the bodies ability to sweat.



3. There are several benefits to studying from this perspective. This information can be useful for several reasons. For example, this information could come in handy for someone who isn't used to extreme heat and would like to take certain precautions before traveling to a climate they were not accustomed to. This could definitely educate an individual from Inuit or Eskimo regions who's body is used to the harsh conditions of the subarctic. They would learn that their larger more round shaped bodies that are built to keep them warm and conserve heat in the arctic, would lead them to become even more susceptible to heat stroke and heat exhausting in more tropical climates. It could also be used in a productive way because it could help them decide what kind of clothing would be acceptable to wear in warmer climates as opposed to the animal skins they are used to wearing in the cold climates they are used to.

4. I don't think race determines the way an individual adapts to heat. All humans have the ability to maintain homeostasis and everyone sweats despite the color of their skin. While it is true that some nationalities prefer different alternatives to cooling themselves down, their bodies all react the same. For example, an American girls clothing in the summer is very different to a Muslim girls clothing. However, they both posses the same sweat glands and they both might drink several glasses of water to stay hydrated. Environmental influences on adaptations would be a better way to understand human variation than by race because race doesn't determine how much sweat our body produces, however our environment might. For example, members of the Masai tribe might produce more sweat than Eskimos in the arctic but this isn't because of their differing races, but because of their environments.

Language Experiment

Part 1:

• This weekend while attempting the language experiment I had some very interesting outcomes. First and foremost this was not as easy as I had anticipated. I asked my two best friends to gather with me during one of our routine weekend hangouts and try having a conversation with me for 15 minutes, the only obstacle was that I wasn't allowed to use any form of symbolic language such as speaking, writing, or ASL. The task seemed easy enough but only a few minutes in and I could already tell it was going to be difficult. Because I am such a vocal person, it was a challenge to try and communicate using only miming motions. My friend Christine was the first to try and communicate with me and attempted several times to interpret my body posture and facial features but all she did was laugh which didn't help include me in the conversation. After not making much advances my friend Kimberlei gave it a try and started  playing charades with me. This worked a little better but our conversation had to be kept rather basic. Kimberlei definitely had to alter the way she usually communicates with me because she had to simplify everything she did in order for me to be able to respond to it. For example, she introduced the topic of going out to eat and which restaurant we should go to. Trying to respond, I had to mime myself eating sushi which is not as easy as it sounds. Although the conversation was frustrating at times, it definitely gave more insight on how important language really is. 

• Had it been two different cultures meeting for the first time, the results would have some positives and negatives. While being able to use your voice would prove to be more positive, it could also be negative. Having a voice would help with getting your point across, and express yourself, so this would be the culture with an advantage. While not having a voice leaves you with only your body and hand movements which could be even more confusing, this would be the disadvantaged culture. The culture that has the advantage of having a voice in this situation, might have a frustrated attitude, because after failed communication with the non-voice disadvantaged culture. An example of a disadvantaged individual in our culture would be someone who is deaf. People who are deaf use forms of ASL to communicate with others and because of this can only communicate with others who are familiar with this language. This also affects those who do speak with ASL because ASL is translated in broken English and this can alter how they read and speak regular English. 

Part 2:

• This part of the experiment was even harder than the first. A few minutes into this part I found myself trying to talk with my hands like I had done before so I had to start over. It was really hard for me not to mime what I wanted to say especially because I naturally speak with my hands to emphasize my points. Without using hand signals, vocal intonation, head, facial, or body movements, my entire conversation felt very stiff as all I did was try and focus on not breaking any of these rules. While I could actually use my voice this time, communicating like normal still seemed to be difficult because I could only use my words. Neither of my friends seemed to be affected during this conversation I think because I was talking, and could communicate easier this time around. Being an animated talker I feel that using hand movements in language is important because it helps emphasize what you're trying to say, and helps animate what you're trying to say. Hand signals such as a thumbs up, peace sign,  or a wave are all  language techniques that help us communicate. While communication could still be done without hand language, it still adds emotion and feeling into what we have to say. 

• Yes there are people who can't read body language. Autistic people are prevented from distinguishing people's feelings because they have visual processing problems. Because of this they have difficulty with social interactions, such as communicating with others as we do. The benefits of having the ability to read someone's body language would be to interpret how they are feeling based on how their body is, for example someone sad would have a low hanging head or maybe their face in their hands. Having this ability would make it easier to communicate with said person, such as speaking in a comforting tone. An example of an environment where you might benefit to not reading body language or showing body language might be an amusement parks haunted maze. You would not want to show body language of being scared because the scare actors are trained to scare you even more so if you do. (Speaking from personal experience here.) 

The Piltdown Man Hoax

             In 1912 near the small New England village of Piltdown, an amateur archaeologist named Charles Dawson claimed to had found a piece of an ancient human skull. Leaving the scientific community in an uproar with new evidence of early human ancestry, this new find promised to give paleontologists and archaeologists exactly what they wanted: the missing link. The missing link being the earliest adaptations of man, "the middle" of the evolutionary path between ape to hominin.  However, the success didn't last long as several scientists began to question Dawsin's finds, especially since no new finds came after his death. With new technology came new evidence leading to the proof of the hoax. Scientists lab tested the fossils by measuring the fluorine content, thus giving a more precise dating. What they found was crucial, not only was the skull not as old as they had been lead to believe, but all the fossils had been stained and carved using a steel knife. In response to this several scientists began to question the evolutionary theory as a whole as all evidence was called into question. Before this, hypothesis were just believed to be true but after seeing the tampered evidence, scientists were forced to further investigate any new evidence so no mistakes would be made.     These human faults affected the scientific process by delaying the progression of new evolutionary theories and evidences. It also put a persons character into play, meaning that scientists couldn't fully be trusted by their evidence unless it was proven legitimate first.
 On a more positive note, the scientific processes that revealed the true nature of the skull were tremendous advances in technology. By using various methods to prove the skull was a hoax, science evolved into a more defined craft. For example, during the lab testing of the skull in 1949, scientists used a new method involving fluoride to date the remains. This was a huge impact in technology and led to another testing in 1953 with even more advanced methods that shed light on the stained fragments, and cut skull.
While it is in human nature to have faults in discovering new things, I do not think it would be wise to completely remove the "human" factor from science. Science is all fault and error, it is in this that new discoveries are made. So, at least in my opinion, without human fault, science would not evolve the way it should.
After reading and watching the videos for this event, I found that it is always best to ask questions, and not just agree with something without seeing more evidence first. I think it is important to take everything into question and analyze it before making any assumptions beforehand, especially in the case of new discovery. For example, when Bigfoot was claimed to have been found. Without the evidence, like pictures or video footage, this claim was merely a claim. And while technology is more useful in providing us with evidence, it can always be just as faulty. 

Dentition Patterns



Lemurs   (Prosimians/Strepsirhini)

Ring-tailed lemurs are found on the island of Madagascar. They are restricted to the south and southwestern portion of the island which includes nine forests: Andohahela, Andringitra, Ankilitelo, Berenty, Beza Mahafaly, Isalo, Tsimanampetsotsa, Tsirave, and Zombitse.A free ranging breeding population however, has been developed in Georgia.  The dentition patterns found in lemurs is 2.1.3.3 on both the top and bottom. This means that on each side of the jaw there are two incisors, one canine tooth, three premolars, and three molars. The lower incisors and lower canines, which are slightly larger, form a structure called a toothcomb which is helpful with oral grooming, grasping small fruits and removing leaves off a stem while eating. The lemurs dentition patterns are influenced by their environment because they rely on their toothcomb to help them while eating plant stems, and small fruits, and grooming themselves.

      


Spider Monkey  (New World Monkey/Platyrrhini)

The spider monkey can be found in the tropical forests of Central and South America including countries such as Brazil and Mexico. Because of their long disproportionate limbs and prehensile tails they are one of the largest New World Monkeys, hence their common name. Thanks to their large size they prefer lush undisturbed forest environments, however because of their size they are common prey for humans.  Spider monkeys live in the uppermost layers of the rain forest surviving off of a diet of mostly fruits, but have also been known to occasionally consume flowers, leaves, and insects. The dentition pattern of a spider monkey is 2.1.3.3, they have two incisors, one canine, three premolars, and three molars. Their teeth have adapted to their aboreal, treetop, lifestyle. Their teeth assist in their eating of fruits and leaves.


  


Baboon  (Old World Monkey/Cercopithecidae)

Baboons are found in various habitats are are extremely adaptable. Preferring semiarid environments, they are more commonly found in the Savannas of Africa, or tropical forests in Africa. They rely on fruits, roots, bark, grass and even seeds for their nutrients. They also eat rodents and birds for their meat. Their dentition pattern is 2.1.2.3. They have broad incisors, molars with high crowns, and extended fang like canine teeth. Their specific dental pattern is essential to their survival in the harsh environments of the African Savanna, and forests because it helps them ward off predators and compete for food.

  

Gibbon  (Lesser ape/Hylobatidae)

Gibbons can be found in tropical to subtropical forests of southeast Asia. Also referred to as lesser apes, Gibbons differ from other apes because of their small size, non nest building, and anatomical characteristics that resemble monkeys more so than apes. Gibbons are omnivores relying on the fruit and leaves around them, as well as small birds, insects, and reptiles. Their dentition pattern is 2.1.2.3 with shortened jaws and long canine teeth. Due to their tree dwelling nature they are prey to animals such as leopards, and large snakes, because of this they must rely on their particularly long canines to defend themselves.
  

Chimpanzees   (Great ape/Hominidae) 

The chimpanzee is a species of ape found in a variety of habitats in western and central Africa from tropical forests to arid savannas. Closely related to humans in particular, humans and chimpanzees share 98% of the same DNA. While the common chimpanzee is herbivorous eating mostly ripe fruits and leaves, they have also been known to feast on honey, small animals and birds, and insects. In close relation to humans, chimpanzees have 32 teeth, 16 on the upper jaw and 16 on the bottom jaw,  that help them grind down plant materials and even rip through flesh. Their dental formula is 2.1.2.3.


 


Through my observations and studying I found that animals that have a more plant based diet tend to have more molars. These are also usually the animals with aboreal natures, seeking refuge in treetop residences. With dental formulas close to or about, 2.1.3.3 they rely on their teeth to help grind and crush leaves and plants. For example, a lemur or a spider monkey are both herbivorous animals with the dental formula, 2.1.3.3, and both reside in lush forest habitats. However, I also found that animals with a more carnivorous diet tended to have larger incisors and less molars.  With a dental formula like 2.1.2.3, animals like the gibbon, chimpanzee, and baboon relied on their larger canine teeth to rip through meats, and scare off predators. These animals were also more aggressive as they had to compete for their meals.

Analogy vs. Homology

Homologous

When comparing two very different creatures it is interesting to find several homologous similarities between them. Dolphins and humans for example, are very different at first glance, but after a second take it is interesting to find exactly how much they have in common. Dolphins are marine mammals in close relation to porpoises and whales. They can be found in warm water such as tropical oceans. To communicate they use a clicking sound that can be heard underwater, and are often very social. Humans, are defined as homo-sapiens closely related to primates. They can be found in all seven continents of the world and communicate in various ways using language.  The human arm and Bottlenose dolphin flipper are very similar, and developed from a common ancestral structure. Though at first glance they are quite different, underneath, their structures both include a humerus, ulna, and radius. The humerus in humans, functions to connect the ulna as the forearms radical bone, to the wrist, and at the shoulder it connects the body to the scapula. The humerus also includes muscular insertion and origination. This all works together to allow humans to successfully move their arms such as reaching for an apple off of a tree. In a dolphin flipper however, all of the said bones are more compact and small. This allows for functions to be more swift and sharper, such as pushing through water. Millions of years ago dolphins and humans must have shared a common ancestor that lived in water and was forced out of sea, onto land. This might have been a dinosaur creature such as the   Thalattoarchon Saurophagis which was essentially a water dinosaur that closely resembles a half lizard half dolphin. While it is weird to think that today's humans could have evolved from a water dinosaur species, it is definitely an interesting theory. 

                              

             

Analogous

Penguins and fish though very different in appearance, share the same analogous trait of fins. Penguins and fish both have the same fin-like structures that help them navigate through aquatic environments. Emperor penguins are flightless birds found in Antarctica. They reside along arctic waters and survive harsh conditions by hunting nearby fish. Covina fish are saltwater fish found in the tropical waters of the southeastern Pacific. It can also be referred to as the croaking fish because of the sound it makes when it head comes above water. A penguins wings are much like a human arm or dolphin fin. They include a humerus, ulna, radius, and phalanges to help them navigate through the treacherous arctic waters. While they are still technically wings, they cannot be used for flight because they are too thin and cannot support the weight of the penguin. This is an example of an analogous trait itself because the wings of the penguin have evolved from their initial use of flight to their present use of swimming. The fins of a fish however, have the same use as the wings of a penguin. While their structures are different, they are still used the same way. Pectoral, anal, and pelvic fins can be found on almost all fish and contributed to the movement of said fish. A fish's fins for example, are comprised of small thin bones, and a webbing to protect them. The principle function of the fin is to help the fish swim. Depending on their location, different fins serve for different swimming purposes such as swimming left or right, or turning, or stopping. While most all species share some common ancestor, I believe that these analogous traits are based on the demands of the environment and not necessarily the ancestral lineage. 

analogous information: http://education-portal.com/academy/lesson/analogous-structures-definition-examples-quiz.html#lesson

DNA Puzzle

Hey guys!

Here's my DNA sentence, have fun :)

ATTGAAGCCGTTGGAAAACGCTAGTGGAATTAGAATC

Jean Baptiste Lamarck & His Early Concepts of Evolution

Jean- Baptiste Lamarck

Jean Baptiste Lamarck had a huge, positive, influence over Darwin's theory of natural selection. With his contributions to the science community at the time, he, along with few others, were the only supporters that early evolutionists had. His most notable studies being the idea of invertebrates, and the theory that all acquired traits are inherited. Much before his time, he created a new field of biology. He discovered by "reorganizing" species of insects and worms, and gathering all the knowledge he could about them, that their diversity in vertebrae led them to be classified differently. This, he felt, showed the true power of nature; nature takes its course in all animals, and all animals change over time. His work with vertebrae also advanced prior works of classification. He was the first to separate crustacean, arachnids, and annelids from insects. "Lamarckisim" is a term used to refer to the theory that acquired traits can be inherited. He believed that a change in environment caused change to the needs of the organisms living in that environment which caused changes in their behavior. Depending on how they behaved, organisms would alter their organs, either larger or smaller according to their demand for use. This became the  "First Law".

http://www.ucmp.berkeley.edu/history/lamarck.html

Going back to the list, "How does evolution work?" I found that the point, "Individuals do not evolve, populations do", directly explained natural selection by using the works of Lamarck. I feel that Lamarck's work had a positive effect on this point because of his idea of heredity. Refuting Lamarck's ideas of heredity at first, Darwin later admitted that hereditary effects may have an impact on evolution. While their initial ideas of evolution may have differed in small details, the outcome is still roughly the same. That is that, change in lineage, caused by change in environment, occurs over long periods of time.

I believe that even without Lamarck's early evolution work, Darwin would have developed his theory of natural selection nonetheless. While much of Lamarck's ideas parallel Darwin's they shared several views, and Darwin even adopted some of Lamarck's theories of shrinking organs in his work.

Darwin's book, The Origin of Species, raised controversy with the Church because it questioned creationism. His work stated that, humans came to their known state by developing over time from a species of animal. This clashed with creationist ideas stating that man comes from God, or a higher power. Because of the controversy, and failure to abide by the status quo,  many of Darwin's friends and associates were concerned with his work being published. This is still a heated topic of debate today, and continues to receive widespread support, as well as scorn.