Thursday, June 26, 2014

DNA Puzzle

Hey guys!

Here's my DNA sentence, have fun :)

ATTGAAGCCGTTGGAAAACGCTAGTGGAATTAGAATC

Tuesday, June 17, 2014

Jean Baptiste Lamarck & His Early Concepts of Evolution

Jean- Baptiste Lamarck


Jean Baptiste Lamarck had a huge, positive, influence over Darwin's theory of natural selection. With his contributions to the science community at the time, he, along with few others, were the only supporters that early evolutionists had. His most notable studies being the idea of invertebrates, and the theory that all acquired traits are inherited. Much before his time, he created a new field of biology. He discovered by "reorganizing" species of insects and worms, and gathering all the knowledge he could about them, that their diversity in vertebrae led them to be classified differently. This, he felt, showed the true power of nature; nature takes its course in all animals, and all animals change over time. His work with vertebrae also advanced prior works of classification. He was the first to separate crustacean, arachnids, and annelids from insects. "Lamarckisim" is a term used to refer to the theory that acquired traits can be inherited. He believed that a change in environment caused change to the needs of the organisms living in that environment which caused changes in their behavior. Depending on how they behaved, organisms would alter their organs, either larger or smaller according to their demand for use. This became the  "First Law".

http://www.ucmp.berkeley.edu/history/lamarck.html

Going back to the list, "How does evolution work?" I found that the point, "Individuals do not evolve, populations do", directly explained natural selection by using the works of Lamarck. I feel that Lamarck's work had a positive effect on this point because of his idea of heredity. Refuting Lamarck's ideas of heredity at first, Darwin later admitted that hereditary effects may have an impact on evolution. While their initial ideas of evolution may have differed in small details, the outcome is still roughly the same. That is that, change in lineage, caused by change in environment, occurs over long periods of time.

I believe that even without Lamarck's early evolution work, Darwin would have developed his theory of natural selection nonetheless. While much of Lamarck's ideas parallel Darwin's they shared several views, and Darwin even adopted some of Lamarck's theories of shrinking organs in his work.

Darwin's book, The Origin of Species, raised controversy with the Church because it questioned creationism. His work stated that, humans came to their known state by developing over time from a species of animal. This clashed with creationist ideas stating that man comes from God, or a higher power. Because of the controversy, and failure to abide by the status quo,  many of Darwin's friends and associates were concerned with his work being published. This is still a heated topic of debate today, and continues to receive widespread support, as well as scorn.